cell lines hek293t 17 atcc crl Search Results


96
ATCC hek293t
( a ) RPE-1 cells were transiently transfected with GFP-HTT97Q and stained for pHSP27 or Ub + . DNA was stained with DAPI. Scale bar 10 μm. ( b ) Immunoblot of soluble and insoluble fractions from WT and PCM1 KO cells transfected with GFP-HTT25Q. GAPDH and Histone H3 were used controls for the soluble and insoluble fractions, respectively. ( c ) Cells were transfected with GFP-HTT97Q for 5 hours, then treated with DMSO or nocodazole for 5 hours before being fixed and stained for GFP and α-tubulin. Scale bar 10 μm. ( d ) Immunoblot of soluble and insoluble fractions from cells prepared as in c . GAPDH and Histone H3 were used controls for the soluble and insoluble fractions, respectively. ( e ) WT and STIL KO U-2 OS cells were transiently transfected with GFP-HTT97Q then stained for GFP, CEP135 and α-tubulin. Scale bar 10 μm. ( f ) Immunoblot of soluble and insoluble fractions from cells prepared as in e . GAPDH and Histone H3 were used controls for the soluble and insoluble fractions, respectively. ( g ) <t>HEK293T-FLAG-miniTurbo-CP110</t> cells were treated and stained as indicated. Scale bar 10 μm, 2 μm. ( h ) Immunoblot of HEK293T-FLAG-miniTurbo-CP110 cells treated and probed as indicated. α-tubulin was used as a loading control. ( i ) The number of preys from DMSO- or MG132-treated groups. Preys were defined as detailed in the Methods. ( j ) Functional enrichment analysis was performed with the preys from i . using g:Profiler and the KEGG database. ( k ) Spectral counts from the genes which are implicated in Parkinson’s disease, proteasome function or Huntington’s disease are shown. Genes which are related to the respective pathways are marked in green. Unprocessed immunoblots are provided as source data. For i , j , k : the raw mass spectrometry data and analysis giving rise to these panels is available in Supplementary Table .
Hek293t, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cell+lines+hek293t+17+atcc+crl/pmc09033585-268-7-11?v=ATCC
Average 96 stars, based on 1 article reviews
hek293t - by Bioz Stars, 2026-08
96/100 stars
  Buy from Supplier

99
ATCC hek293t atcc crl 11268 oligonucleotides rt qpcr primer atf4 f atgaccgaaatgagcttcctg
( a ) RPE-1 cells were transiently transfected with GFP-HTT97Q and stained for pHSP27 or Ub + . DNA was stained with DAPI. Scale bar 10 μm. ( b ) Immunoblot of soluble and insoluble fractions from WT and PCM1 KO cells transfected with GFP-HTT25Q. GAPDH and Histone H3 were used controls for the soluble and insoluble fractions, respectively. ( c ) Cells were transfected with GFP-HTT97Q for 5 hours, then treated with DMSO or nocodazole for 5 hours before being fixed and stained for GFP and α-tubulin. Scale bar 10 μm. ( d ) Immunoblot of soluble and insoluble fractions from cells prepared as in c . GAPDH and Histone H3 were used controls for the soluble and insoluble fractions, respectively. ( e ) WT and STIL KO U-2 OS cells were transiently transfected with GFP-HTT97Q then stained for GFP, CEP135 and α-tubulin. Scale bar 10 μm. ( f ) Immunoblot of soluble and insoluble fractions from cells prepared as in e . GAPDH and Histone H3 were used controls for the soluble and insoluble fractions, respectively. ( g ) <t>HEK293T-FLAG-miniTurbo-CP110</t> cells were treated and stained as indicated. Scale bar 10 μm, 2 μm. ( h ) Immunoblot of HEK293T-FLAG-miniTurbo-CP110 cells treated and probed as indicated. α-tubulin was used as a loading control. ( i ) The number of preys from DMSO- or MG132-treated groups. Preys were defined as detailed in the Methods. ( j ) Functional enrichment analysis was performed with the preys from i . using g:Profiler and the KEGG database. ( k ) Spectral counts from the genes which are implicated in Parkinson’s disease, proteasome function or Huntington’s disease are shown. Genes which are related to the respective pathways are marked in green. Unprocessed immunoblots are provided as source data. For i , j , k : the raw mass spectrometry data and analysis giving rise to these panels is available in Supplementary Table .
Hek293t Atcc Crl 11268 Oligonucleotides Rt Qpcr Primer Atf4 F Atgaccgaaatgagcttcctg, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cell+lines+hek293t+17+atcc+crl/pm30184506-273-0-1?v=ATCC
Average 99 stars, based on 1 article reviews
hek293t atcc crl 11268 oligonucleotides rt qpcr primer atf4 f atgaccgaaatgagcttcctg - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

94
ATCC hek293t 17 cells
( a ) RPE-1 cells were transiently transfected with GFP-HTT97Q and stained for pHSP27 or Ub + . DNA was stained with DAPI. Scale bar 10 μm. ( b ) Immunoblot of soluble and insoluble fractions from WT and PCM1 KO cells transfected with GFP-HTT25Q. GAPDH and Histone H3 were used controls for the soluble and insoluble fractions, respectively. ( c ) Cells were transfected with GFP-HTT97Q for 5 hours, then treated with DMSO or nocodazole for 5 hours before being fixed and stained for GFP and α-tubulin. Scale bar 10 μm. ( d ) Immunoblot of soluble and insoluble fractions from cells prepared as in c . GAPDH and Histone H3 were used controls for the soluble and insoluble fractions, respectively. ( e ) WT and STIL KO U-2 OS cells were transiently transfected with GFP-HTT97Q then stained for GFP, CEP135 and α-tubulin. Scale bar 10 μm. ( f ) Immunoblot of soluble and insoluble fractions from cells prepared as in e . GAPDH and Histone H3 were used controls for the soluble and insoluble fractions, respectively. ( g ) <t>HEK293T-FLAG-miniTurbo-CP110</t> cells were treated and stained as indicated. Scale bar 10 μm, 2 μm. ( h ) Immunoblot of HEK293T-FLAG-miniTurbo-CP110 cells treated and probed as indicated. α-tubulin was used as a loading control. ( i ) The number of preys from DMSO- or MG132-treated groups. Preys were defined as detailed in the Methods. ( j ) Functional enrichment analysis was performed with the preys from i . using g:Profiler and the KEGG database. ( k ) Spectral counts from the genes which are implicated in Parkinson’s disease, proteasome function or Huntington’s disease are shown. Genes which are related to the respective pathways are marked in green. Unprocessed immunoblots are provided as source data. For i , j , k : the raw mass spectrometry data and analysis giving rise to these panels is available in Supplementary Table .
Hek293t 17 Cells, supplied by ATCC, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cell+lines+hek293t+17+atcc+crl/bio_rxiv__2021__09__02__458782-299-6-8?v=ATCC
Average 94 stars, based on 1 article reviews
hek293t 17 cells - by Bioz Stars, 2026-08
94/100 stars
  Buy from Supplier

99
ATCC hek293t cells
a , Quantification of EPSC inhibition versus applied wavelengths for Lc PPO (right) and Pd CO (left) including single cell measurement data points. For each cell, the inhibition was normalized to the maximum inhibition. Lines show dose-response fits. n = 6–15. b , Wavelength sensitivity of light induced recovery including single cell measurement data for Lc PPO (right) and Pd CO (left). n = 4–7. c , Quantification of absolute inhibition for the first EPSC post sample illumination versus light flux for (from left to right) Lc PPO (365 nm), Pd CO (405 nm) and As OPN3 (520 nm) including single cell measurement data points. Lines depict sigmoidal fits to calculate half maximal inhibition light flux (EC 50 ) values. n = 3–17. d , Top: schematic of 2-photon (2p) recordings in <t>HEK293T</t> cells co-transfected with Pd CO-mScarlet and GIRK2.1 in a 1:3 ratio. Whole-cell patch-clamp recordings were performed and Pd CO was activated with 2p raster scanning. Bottom: example recordings at various 2p wavelengths while applying a voltage ramp from −120 to +40mV. e , Top: example recordings of one representative HEK293T cell at −120mV holding potential for different scan wavelengths as indicated. Bottom: Quantification of 2p wavelength sensitivity; n = 6–8. Data was fitted with a 3-parametric Weibull distribution (red line) f , Top: example recordings of a representative HEK293T cell at −120mV for different 2p intensities of 800 nm. Bottom: Quantification of 2p sensitivity at 800 nm; n = 6–8. Data was fitted with a logistic dose response curve to determine the EC 50 value (red line). All data is shown as mean ± SEM.
Hek293t Cells, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cell+lines+hek293t+17+atcc+crl/pmc11239505-350-11-14?v=ATCC
Average 99 stars, based on 1 article reviews
hek293t cells - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

96
ATCC hek293t 17
a , Quantification of EPSC inhibition versus applied wavelengths for Lc PPO (right) and Pd CO (left) including single cell measurement data points. For each cell, the inhibition was normalized to the maximum inhibition. Lines show dose-response fits. n = 6–15. b , Wavelength sensitivity of light induced recovery including single cell measurement data for Lc PPO (right) and Pd CO (left). n = 4–7. c , Quantification of absolute inhibition for the first EPSC post sample illumination versus light flux for (from left to right) Lc PPO (365 nm), Pd CO (405 nm) and As OPN3 (520 nm) including single cell measurement data points. Lines depict sigmoidal fits to calculate half maximal inhibition light flux (EC 50 ) values. n = 3–17. d , Top: schematic of 2-photon (2p) recordings in <t>HEK293T</t> cells co-transfected with Pd CO-mScarlet and GIRK2.1 in a 1:3 ratio. Whole-cell patch-clamp recordings were performed and Pd CO was activated with 2p raster scanning. Bottom: example recordings at various 2p wavelengths while applying a voltage ramp from −120 to +40mV. e , Top: example recordings of one representative HEK293T cell at −120mV holding potential for different scan wavelengths as indicated. Bottom: Quantification of 2p wavelength sensitivity; n = 6–8. Data was fitted with a 3-parametric Weibull distribution (red line) f , Top: example recordings of a representative HEK293T cell at −120mV for different 2p intensities of 800 nm. Bottom: Quantification of 2p sensitivity at 800 nm; n = 6–8. Data was fitted with a logistic dose response curve to determine the EC 50 value (red line). All data is shown as mean ± SEM.
Hek293t 17, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cell+lines+hek293t+17+atcc+crl/10__1158_slash_0008___5472__can___17___1052-35-0-1?v=ATCC
Average 96 stars, based on 1 article reviews
hek293t 17 - by Bioz Stars, 2026-08
96/100 stars
  Buy from Supplier

90
ImmunoGen Inc hek 293t/17 cells
a , Quantification of EPSC inhibition versus applied wavelengths for Lc PPO (right) and Pd CO (left) including single cell measurement data points. For each cell, the inhibition was normalized to the maximum inhibition. Lines show dose-response fits. n = 6–15. b , Wavelength sensitivity of light induced recovery including single cell measurement data for Lc PPO (right) and Pd CO (left). n = 4–7. c , Quantification of absolute inhibition for the first EPSC post sample illumination versus light flux for (from left to right) Lc PPO (365 nm), Pd CO (405 nm) and As OPN3 (520 nm) including single cell measurement data points. Lines depict sigmoidal fits to calculate half maximal inhibition light flux (EC 50 ) values. n = 3–17. d , Top: schematic of 2-photon (2p) recordings in <t>HEK293T</t> cells co-transfected with Pd CO-mScarlet and GIRK2.1 in a 1:3 ratio. Whole-cell patch-clamp recordings were performed and Pd CO was activated with 2p raster scanning. Bottom: example recordings at various 2p wavelengths while applying a voltage ramp from −120 to +40mV. e , Top: example recordings of one representative HEK293T cell at −120mV holding potential for different scan wavelengths as indicated. Bottom: Quantification of 2p wavelength sensitivity; n = 6–8. Data was fitted with a 3-parametric Weibull distribution (red line) f , Top: example recordings of a representative HEK293T cell at −120mV for different 2p intensities of 800 nm. Bottom: Quantification of 2p sensitivity at 800 nm; n = 6–8. Data was fitted with a logistic dose response curve to determine the EC 50 value (red line). All data is shown as mean ± SEM.
Hek 293t/17 Cells, supplied by ImmunoGen Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cell+lines+hek293t+17+atcc+crl/pmc06789618-38-12-30?v=ImmunoGen+Inc
Average 90 stars, based on 1 article reviews
hek 293t/17 cells - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

99
ATCC antibodies human embryonic kidney 293 t
a , Quantification of EPSC inhibition versus applied wavelengths for Lc PPO (right) and Pd CO (left) including single cell measurement data points. For each cell, the inhibition was normalized to the maximum inhibition. Lines show dose-response fits. n = 6–15. b , Wavelength sensitivity of light induced recovery including single cell measurement data for Lc PPO (right) and Pd CO (left). n = 4–7. c , Quantification of absolute inhibition for the first EPSC post sample illumination versus light flux for (from left to right) Lc PPO (365 nm), Pd CO (405 nm) and As OPN3 (520 nm) including single cell measurement data points. Lines depict sigmoidal fits to calculate half maximal inhibition light flux (EC 50 ) values. n = 3–17. d , Top: schematic of 2-photon (2p) recordings in <t>HEK293T</t> cells co-transfected with Pd CO-mScarlet and GIRK2.1 in a 1:3 ratio. Whole-cell patch-clamp recordings were performed and Pd CO was activated with 2p raster scanning. Bottom: example recordings at various 2p wavelengths while applying a voltage ramp from −120 to +40mV. e , Top: example recordings of one representative HEK293T cell at −120mV holding potential for different scan wavelengths as indicated. Bottom: Quantification of 2p wavelength sensitivity; n = 6–8. Data was fitted with a 3-parametric Weibull distribution (red line) f , Top: example recordings of a representative HEK293T cell at −120mV for different 2p intensities of 800 nm. Bottom: Quantification of 2p sensitivity at 800 nm; n = 6–8. Data was fitted with a logistic dose response curve to determine the EC 50 value (red line). All data is shown as mean ± SEM.
Antibodies Human Embryonic Kidney 293 T, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cell+lines+hek293t+17+atcc+crl/pm25216694-107-4-21?v=ATCC
Average 99 stars, based on 1 article reviews
antibodies human embryonic kidney 293 t - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

90
Lonza huvecs
a , Quantification of EPSC inhibition versus applied wavelengths for Lc PPO (right) and Pd CO (left) including single cell measurement data points. For each cell, the inhibition was normalized to the maximum inhibition. Lines show dose-response fits. n = 6–15. b , Wavelength sensitivity of light induced recovery including single cell measurement data for Lc PPO (right) and Pd CO (left). n = 4–7. c , Quantification of absolute inhibition for the first EPSC post sample illumination versus light flux for (from left to right) Lc PPO (365 nm), Pd CO (405 nm) and As OPN3 (520 nm) including single cell measurement data points. Lines depict sigmoidal fits to calculate half maximal inhibition light flux (EC 50 ) values. n = 3–17. d , Top: schematic of 2-photon (2p) recordings in <t>HEK293T</t> cells co-transfected with Pd CO-mScarlet and GIRK2.1 in a 1:3 ratio. Whole-cell patch-clamp recordings were performed and Pd CO was activated with 2p raster scanning. Bottom: example recordings at various 2p wavelengths while applying a voltage ramp from −120 to +40mV. e , Top: example recordings of one representative HEK293T cell at −120mV holding potential for different scan wavelengths as indicated. Bottom: Quantification of 2p wavelength sensitivity; n = 6–8. Data was fitted with a 3-parametric Weibull distribution (red line) f , Top: example recordings of a representative HEK293T cell at −120mV for different 2p intensities of 800 nm. Bottom: Quantification of 2p sensitivity at 800 nm; n = 6–8. Data was fitted with a logistic dose response curve to determine the EC 50 value (red line). All data is shown as mean ± SEM.
Huvecs, supplied by Lonza, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cell+lines+hek293t+17+atcc+crl/pmc05225310-80-10-7?v=Lonza
Average 90 stars, based on 1 article reviews
huvecs - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

98
Addgene inc hek293t 17 cells with pspax2
a , Quantification of EPSC inhibition versus applied wavelengths for Lc PPO (right) and Pd CO (left) including single cell measurement data points. For each cell, the inhibition was normalized to the maximum inhibition. Lines show dose-response fits. n = 6–15. b , Wavelength sensitivity of light induced recovery including single cell measurement data for Lc PPO (right) and Pd CO (left). n = 4–7. c , Quantification of absolute inhibition for the first EPSC post sample illumination versus light flux for (from left to right) Lc PPO (365 nm), Pd CO (405 nm) and As OPN3 (520 nm) including single cell measurement data points. Lines depict sigmoidal fits to calculate half maximal inhibition light flux (EC 50 ) values. n = 3–17. d , Top: schematic of 2-photon (2p) recordings in <t>HEK293T</t> cells co-transfected with Pd CO-mScarlet and GIRK2.1 in a 1:3 ratio. Whole-cell patch-clamp recordings were performed and Pd CO was activated with 2p raster scanning. Bottom: example recordings at various 2p wavelengths while applying a voltage ramp from −120 to +40mV. e , Top: example recordings of one representative HEK293T cell at −120mV holding potential for different scan wavelengths as indicated. Bottom: Quantification of 2p wavelength sensitivity; n = 6–8. Data was fitted with a 3-parametric Weibull distribution (red line) f , Top: example recordings of a representative HEK293T cell at −120mV for different 2p intensities of 800 nm. Bottom: Quantification of 2p sensitivity at 800 nm; n = 6–8. Data was fitted with a logistic dose response curve to determine the EC 50 value (red line). All data is shown as mean ± SEM.
Hek293t 17 Cells With Pspax2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cell+lines+hek293t+17+atcc+crl/pmc03071698-52-7-11?v=Addgene+inc
Average 98 stars, based on 1 article reviews
hek293t 17 cells with pspax2 - by Bioz Stars, 2026-08
98/100 stars
  Buy from Supplier

99
ATCC human embryonic kidney hek 293t 17 cells
a , Quantification of EPSC inhibition versus applied wavelengths for Lc PPO (right) and Pd CO (left) including single cell measurement data points. For each cell, the inhibition was normalized to the maximum inhibition. Lines show dose-response fits. n = 6–15. b , Wavelength sensitivity of light induced recovery including single cell measurement data for Lc PPO (right) and Pd CO (left). n = 4–7. c , Quantification of absolute inhibition for the first EPSC post sample illumination versus light flux for (from left to right) Lc PPO (365 nm), Pd CO (405 nm) and As OPN3 (520 nm) including single cell measurement data points. Lines depict sigmoidal fits to calculate half maximal inhibition light flux (EC 50 ) values. n = 3–17. d , Top: schematic of 2-photon (2p) recordings in <t>HEK293T</t> cells co-transfected with Pd CO-mScarlet and GIRK2.1 in a 1:3 ratio. Whole-cell patch-clamp recordings were performed and Pd CO was activated with 2p raster scanning. Bottom: example recordings at various 2p wavelengths while applying a voltage ramp from −120 to +40mV. e , Top: example recordings of one representative HEK293T cell at −120mV holding potential for different scan wavelengths as indicated. Bottom: Quantification of 2p wavelength sensitivity; n = 6–8. Data was fitted with a 3-parametric Weibull distribution (red line) f , Top: example recordings of a representative HEK293T cell at −120mV for different 2p intensities of 800 nm. Bottom: Quantification of 2p sensitivity at 800 nm; n = 6–8. Data was fitted with a logistic dose response curve to determine the EC 50 value (red line). All data is shown as mean ± SEM.
Human Embryonic Kidney Hek 293t 17 Cells, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cell+lines+hek293t+17+atcc+crl/pm41533802-342-1-7?v=ATCC
Average 99 stars, based on 1 article reviews
human embryonic kidney hek 293t 17 cells - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

Image Search Results


( a ) RPE-1 cells were transiently transfected with GFP-HTT97Q and stained for pHSP27 or Ub + . DNA was stained with DAPI. Scale bar 10 μm. ( b ) Immunoblot of soluble and insoluble fractions from WT and PCM1 KO cells transfected with GFP-HTT25Q. GAPDH and Histone H3 were used controls for the soluble and insoluble fractions, respectively. ( c ) Cells were transfected with GFP-HTT97Q for 5 hours, then treated with DMSO or nocodazole for 5 hours before being fixed and stained for GFP and α-tubulin. Scale bar 10 μm. ( d ) Immunoblot of soluble and insoluble fractions from cells prepared as in c . GAPDH and Histone H3 were used controls for the soluble and insoluble fractions, respectively. ( e ) WT and STIL KO U-2 OS cells were transiently transfected with GFP-HTT97Q then stained for GFP, CEP135 and α-tubulin. Scale bar 10 μm. ( f ) Immunoblot of soluble and insoluble fractions from cells prepared as in e . GAPDH and Histone H3 were used controls for the soluble and insoluble fractions, respectively. ( g ) HEK293T-FLAG-miniTurbo-CP110 cells were treated and stained as indicated. Scale bar 10 μm, 2 μm. ( h ) Immunoblot of HEK293T-FLAG-miniTurbo-CP110 cells treated and probed as indicated. α-tubulin was used as a loading control. ( i ) The number of preys from DMSO- or MG132-treated groups. Preys were defined as detailed in the Methods. ( j ) Functional enrichment analysis was performed with the preys from i . using g:Profiler and the KEGG database. ( k ) Spectral counts from the genes which are implicated in Parkinson’s disease, proteasome function or Huntington’s disease are shown. Genes which are related to the respective pathways are marked in green. Unprocessed immunoblots are provided as source data. For i , j , k : the raw mass spectrometry data and analysis giving rise to these panels is available in Supplementary Table .

Journal: Nature Cell Biology

Article Title: Aggresome assembly at the centrosome is driven by CP110–CEP97–CEP290 and centriolar satellites

doi: 10.1038/s41556-022-00869-0

Figure Lengend Snippet: ( a ) RPE-1 cells were transiently transfected with GFP-HTT97Q and stained for pHSP27 or Ub + . DNA was stained with DAPI. Scale bar 10 μm. ( b ) Immunoblot of soluble and insoluble fractions from WT and PCM1 KO cells transfected with GFP-HTT25Q. GAPDH and Histone H3 were used controls for the soluble and insoluble fractions, respectively. ( c ) Cells were transfected with GFP-HTT97Q for 5 hours, then treated with DMSO or nocodazole for 5 hours before being fixed and stained for GFP and α-tubulin. Scale bar 10 μm. ( d ) Immunoblot of soluble and insoluble fractions from cells prepared as in c . GAPDH and Histone H3 were used controls for the soluble and insoluble fractions, respectively. ( e ) WT and STIL KO U-2 OS cells were transiently transfected with GFP-HTT97Q then stained for GFP, CEP135 and α-tubulin. Scale bar 10 μm. ( f ) Immunoblot of soluble and insoluble fractions from cells prepared as in e . GAPDH and Histone H3 were used controls for the soluble and insoluble fractions, respectively. ( g ) HEK293T-FLAG-miniTurbo-CP110 cells were treated and stained as indicated. Scale bar 10 μm, 2 μm. ( h ) Immunoblot of HEK293T-FLAG-miniTurbo-CP110 cells treated and probed as indicated. α-tubulin was used as a loading control. ( i ) The number of preys from DMSO- or MG132-treated groups. Preys were defined as detailed in the Methods. ( j ) Functional enrichment analysis was performed with the preys from i . using g:Profiler and the KEGG database. ( k ) Spectral counts from the genes which are implicated in Parkinson’s disease, proteasome function or Huntington’s disease are shown. Genes which are related to the respective pathways are marked in green. Unprocessed immunoblots are provided as source data. For i , j , k : the raw mass spectrometry data and analysis giving rise to these panels is available in Supplementary Table .

Article Snippet: To produce lentivirus, 4 × 10 6 HEK293T (female, human kidney; ATCC, ACS-4500) cells were seeded in a T-75 flask and transfected with the relevant lentiviral transfer vector, 3 μg psPAX2 and 2 μg pCMV-VSV-G using Lipofectamine 3000 (Invitrogen).

Techniques: Transfection, Staining, Western Blot, Control, Functional Assay, Mass Spectrometry

a , Quantification of EPSC inhibition versus applied wavelengths for Lc PPO (right) and Pd CO (left) including single cell measurement data points. For each cell, the inhibition was normalized to the maximum inhibition. Lines show dose-response fits. n = 6–15. b , Wavelength sensitivity of light induced recovery including single cell measurement data for Lc PPO (right) and Pd CO (left). n = 4–7. c , Quantification of absolute inhibition for the first EPSC post sample illumination versus light flux for (from left to right) Lc PPO (365 nm), Pd CO (405 nm) and As OPN3 (520 nm) including single cell measurement data points. Lines depict sigmoidal fits to calculate half maximal inhibition light flux (EC 50 ) values. n = 3–17. d , Top: schematic of 2-photon (2p) recordings in HEK293T cells co-transfected with Pd CO-mScarlet and GIRK2.1 in a 1:3 ratio. Whole-cell patch-clamp recordings were performed and Pd CO was activated with 2p raster scanning. Bottom: example recordings at various 2p wavelengths while applying a voltage ramp from −120 to +40mV. e , Top: example recordings of one representative HEK293T cell at −120mV holding potential for different scan wavelengths as indicated. Bottom: Quantification of 2p wavelength sensitivity; n = 6–8. Data was fitted with a 3-parametric Weibull distribution (red line) f , Top: example recordings of a representative HEK293T cell at −120mV for different 2p intensities of 800 nm. Bottom: Quantification of 2p sensitivity at 800 nm; n = 6–8. Data was fitted with a logistic dose response curve to determine the EC 50 value (red line). All data is shown as mean ± SEM.

Journal: Nature Methods

Article Title: A bistable inhibitory optoGPCR for multiplexed optogenetic control of neural circuits

doi: 10.1038/s41592-024-02285-8

Figure Lengend Snippet: a , Quantification of EPSC inhibition versus applied wavelengths for Lc PPO (right) and Pd CO (left) including single cell measurement data points. For each cell, the inhibition was normalized to the maximum inhibition. Lines show dose-response fits. n = 6–15. b , Wavelength sensitivity of light induced recovery including single cell measurement data for Lc PPO (right) and Pd CO (left). n = 4–7. c , Quantification of absolute inhibition for the first EPSC post sample illumination versus light flux for (from left to right) Lc PPO (365 nm), Pd CO (405 nm) and As OPN3 (520 nm) including single cell measurement data points. Lines depict sigmoidal fits to calculate half maximal inhibition light flux (EC 50 ) values. n = 3–17. d , Top: schematic of 2-photon (2p) recordings in HEK293T cells co-transfected with Pd CO-mScarlet and GIRK2.1 in a 1:3 ratio. Whole-cell patch-clamp recordings were performed and Pd CO was activated with 2p raster scanning. Bottom: example recordings at various 2p wavelengths while applying a voltage ramp from −120 to +40mV. e , Top: example recordings of one representative HEK293T cell at −120mV holding potential for different scan wavelengths as indicated. Bottom: Quantification of 2p wavelength sensitivity; n = 6–8. Data was fitted with a 3-parametric Weibull distribution (red line) f , Top: example recordings of a representative HEK293T cell at −120mV for different 2p intensities of 800 nm. Bottom: Quantification of 2p sensitivity at 800 nm; n = 6–8. Data was fitted with a logistic dose response curve to determine the EC 50 value (red line). All data is shown as mean ± SEM.

Article Snippet: For two-photon activation of Pd CO, electrophysiological recordings were performed on HEK293T cells (HEK293T/17, American Type Culture Collection, CRL-1573) as described previously .

Techniques: Inhibition, Transfection, Patch Clamp